PseudoViewer Web Application for windows

PseudoViewer is not for prediction, but for visualization.
It needs both of the sequence (Ex: CCUUACCUCGGGUAGAGGCCCA)
and the structure (Ex: (((::[[[[)))::]]]]::::).

Microsoft .NET Framework Version 1.1 should be installed first to run PseudoViewer in this page.
This page is only for Windows system.
Download Microsoft .NET Framework Version 1.1 Redistributable Package