Usage

Menu  | Input format  | Editor  | Web application for any systems

Bracket view I, II, III, Paired Positions, Multiple sequences, bpseq, ct, PseudoBase format PseudoViewer takes as input the structure data in the bracket view in one of the following styles or paired positions. The structure data given in bracket view III or paired positions are automatically converted into bracket view II and shown in the structure data window. The bracket view describes pseudoknots and secondary structures in one of the following styles.

Bracket view I

# <RNA name> // optional line <starting base number> //optional; if the starting base number is not specified, it is 1 by default. <base sequence > <matching parentheses and brackets>

# TYMV 1 UUAGCUCGCCAGUUAGCGAGGUCUGUCCCCACACGACAGAUAAUCGGGUG CAACUCCCGCCCCUUUUCCGAGGGUCAUCGGAACCA ....(((((......))))).((((((.......))))))....((((.. .....))))(((...[[[[[[)))...]]]]]]...

Bracket view II

# <RNA name > // optional line <starting base number> // optional; if the starting base number is not specified, it is 1 by default. <base sequence> //alternates with <matching parentheses and brackets>

# TYMV 1 UUAGCUCGCCAGUUAGCGAGGUCUGUCCCCACACGACAGAUAAUCGGGUG ....(((((......))))).((((((.......))))))....((((.. CAACUCCCGCCCCUUUUCCGAGGGUCAUCGGAACCA .....))))(((...[[[[[[)))...]]]]]]...

Bracket view III

$ <starting number> <base sequence> // A sequence line alternates with % <starting number> <matching parentheses and brackets> // a structure data line.

$ 1 UUAGCUCGCCAGUUAGCGAGGUCUGUCCCCACACGACAGAUAAUCGGGUG % 1 ....(((((......))))).((((((.......))))))....((((.. $ 51 CAACUCCCGCCCCUUUUCCGAGGGUCAUCGGAACCA % 51 .....))))(((...[[[[[[)))...]]]]]]...

Paired Positions If a user knows the stem positions only and does not know how to represent the structure in bracket view, he can simply provide the stem positions in the following format, which is also used in PseudoBase. Given stem positions, PseudoViewer3 automatically generates the structure data in bracket view and visualize the structure.

# <RNA name> // optional line <starting base number> //optional; if the starting base number is not specified, it is 1 by default. <base sequence > Positions paired. <Starting position of the stem opening part>-<ending position of the stem opening part>; <starting position of the stem-closing part>-<ending position of the stem closing part>

# Hepatitis delta virus (pseudoknot only) 688 GGCCGGCAUGGUCCCAGCCUCCUCGCUGGCGCCGGCUGGGCAA CAUUCCGAGGGGACCGUCCCCUCGGUAAUGGCGAAUGGGACC Positions paired. 688-694; 718-724 697-703; 766-772 704-706; 715-717 708-709; 725-726 731-734; 757-760 735-743; 747-755

Multiple sequences If some part of sequence is omitted, user can use the input format follows.

# <RNA name > // optional line <starting base number> // optional; if the starting base number is not specified, it is 1 by default. <base sequence> //alternates with <matching parentheses and brackets> <starting base number> // optional; if this is omitted, the starting number is 1 by default. /<base sequence> //alternates with /<matching parentheses and brackets>

# PKB128 (Berne virus) 1045 UUUAAACUGUUGAGAGGUGCCUGGAGCGCCUGCAGGCAUCUCUGUU ............(((((((((((....[[[[[)))))))))))... 1150 /UAUAAUGCAGGCA /.......]]]]].

bpseq format

ct format

Tertiary interaction data

Tertiary interactions other than pseudoknots are represented in a pair of matching braces (¡®{}¡¯) in the structure data, and are displayed in dotted lines in the final structure drawing. It helps represent other tertiary interactions than pseudoknots.